E. Fiallo-Olivé1,2, Y. Martínez-Zubiaur2* and R.F. Rivera-Bustamante3
1 Department of Microbiology, Faculty of Biology, University of Havana, Cuba
2 Laboratory of Plant Molecular Virology, National Centre for Animal and Plant Health (CENSA), Cuba
3 Department of Plant Genetic Engineer, CINVESTAV-IPN/Unidad Irapuato, Mexico
*yamila@censa.edu.cu
Accepted: 24 Feb 2009
In Cuba, the monopartite Tomato yellow leaf curl virus (TYLCV) is the most wide-spread begomovirus infecting tomato (Solanum lycopersicum) that causes the major losses in all production areas, although two bipartite begomoviruses affecting tomatoes have been identified (Martínez et al., 1997; Ramos et al., 1997). In January 2007, symptoms of yellow mottle and leaf distortion appeared on tomato plants across eastern Cuba. These symptoms differ from those caused by TYLCV-IL[CU] in lacking the typical leaf curling.
DNA was isolated from 35 symptomatic leaf samples and tested with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC) using PCR. The absence of TYLCV was demonstrated in four DNA samples which showed amplification with generic primers for bipartite begomovirus components DNA A and B (amplicons of approximately 1.1 and 1.2 kb, respectively), demonstrating the presence of a bipartite begomovirus (Rojas et al., 1993). These samples showed strong hybridisation signals in Southern blots using av1 and bc1/bv1 genes from Pepper golden mosaic virus as probes, under low stringency conditions. The positive samples were amplified by rolling-circle amplification and the DNA-A was cloned in pBlueScript vector using EcoRI, a restriction enzyme with only one restriction site in the genomic component. A single clone was sequenced (GenBank Accession No. FJ174698) and showed the typical genome organization of bipartite begomoviruses. The sequence was compared with those from other begomoviruses using the program CLUSTAL V and showed less than 89% nucleotide sequence identity (the species demarcation threshold) to all previously reported begomoviruses. The highest identity (83.9%) was with Wissadula golden mosaic St Thomas virus (DQ395343). The data indicates that the begomovirus infecting tomato is a new species for which we propose the name Tomato yellow leaf distortion virus (ToYLDV). Additional work is now needed to determine the distribution of this new virus in tomato production areas of the country and to quantify the losses it causes.
The authors would like to thank Red Latinoamericana de Botánica for a fellowship (RLB08-P10) to E. Fiallo-Olivé.
Martinez Y, De Blas C, Zabalgogeazcoa I, Quiñones M, Castilian C, Peralta EL, Romero J, 1997. A bipartite geminivirus infecting tomatoes in Cuba. Plant Disease 81, 1215.
Ramos PL, Guerra O, Peral R, Oramas P, Guevara RG, Rivera-Bustamante R, 1997. Taino tomato mottle virus, a new bipartite Geminivirus from Cuba. Plant Disease 81, 1095.
Rojas MR, Gilbertson RL, Russell DR, Maxwell DP, 1993. Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77, 340-347.
©2009 The Authors