R.Y. Xiong1,2, Z.B.Cheng2, J.X. Wu1, Y.J. Zhou2, T. Zhou2 and X.P. Zhou1*
1 State Key Laboratory of Rice Biology, Institute of Biotechnology, Zhejiang University, Hangzhou 310029, People’s Republic of China
2 Institute of Plant Protection, Jiangsu Academy of Sciences, Nanjing 210014, People’s Republic of China
*zzhou@zju.edu.cn
Accepted: 12 Jan 2007
During 2004 and 2005, a disease outbreak was observed on wheat in Jiangsu province, China, with plants showing yellow stripe symptoms (Fig. 1). Rice stripe virus (RSV; Genus Tenuivirus) was detected in leaf samples by an enzyme-linked immunosorbent assay (ELISA) using RSV-specific monoclonal antibodies. Using this assay, a survey found that 84% of wheat fields were infected by RSV in Funing county in 2005, with the incidence in fields ranged from 3.33 to 70%. In other counties, 3-6% of wheat plants were found to be infected by RSV.
The virus was transmitted to healthy wheat plants by the small brown planthopper, Laodelphax striatellus; the known vector of RSV (Toriyama, 2000). Infected plants produced yellow stripe symptoms, which were identical to those observed in fields. A virus isolate JS-YM was obtained from a wheat field in Huaian, Jiangsu province in May 2005. Total RNA was extracted from the plant and RT-PCR was performed using RSV-specific primer pairs NS2-F (TCGGATCCATGGCATTACTCCTTTTCAATG) and NS2-R (GCGTCGACTCACATTAGAATAGGACACTCA), NS3-F (TCGGATCCATGAACGTGTT CACATCGTC) and NS3-R (CAGTCGACCTACAGCACAGCTGGAGAG), and CP-F (GAGGATCCATGGGTACCAACAAGCCAG) and CP-R (TCGTCGACCTAGTCATCTGCA CCTTCTG) to amplify the NS2, NS3 and nucleoprotein genes of RSV respectively. Amplicons of the expected size were obtained from infected but not from healthy leaf samples. The PCR products were cloned and sequenced, with all the sequences confirmed by comparing duplicate clones. Alignment of the sequences (GenBank accession numbers AM397832-34) showed that they shared 97.3%, 97.5% and 97% sequence identity at the nucleotide level and 99%, 97.6% and 98.5% at amino acid level with the NS2, NS3 and nucleoprotein genes respectively of RSV isolate T (Acc. No. NC003754 and NC003776). These results indicate that the virus associated with yellow stripe disease of wheat in Jiangsu is an isolate of RSV. RSV is already known to be common in rice crops in China (Toriyama, 2000). However, this is the first record of RSV being widespread in wheat. This has major implications for the control of the disease.
Toriyama S, 2000. Rice stripe virus AAB Descriptions of Plant Viruses No. 375 [www.dpvweb.net/dpv/showdpv.php?dpvno=375]
©2007 The Authors