B. Mandal1*, S. Mandal1, S.S. Sohrab1, K.B. Pun2 and A. Varma1
1 Advanced Center for Plant Virology, Indian Agricultural Research Institute (IARI), New Delhi-110012, India
2 IARI Regional Station, Kalimpong, West Bengal-734301, India
*leafcurl@rediffmail.com
Accepted: 04 Apr 2000
Chayote (Sechium edule) is a cucurbit vegetable commonly grown in the summer-rainy season in the Darjeeling and Sikkim hills regions of India. Plants were observed to be affected by a yellow mosaic disease, where leaves of affected plants developed yellow spots, mosaic and upward curling with occasional enations (Fig. 1).
Leaf samples with and without symptoms were tested for possible virus infection by electron microscopy (EM), dot-blot hybridisation, polymerase chain reaction (PCR) and inoculation to test plants under insect proof conditions. No virus particles were observed in EM of leaf extracts stained with uranyl acetate. However, PCR and dot-blot hybridisation showed an association of a begomovirus with the disease. PCR using a set of primers derived from the coat protein (CP) gene of Tomato leaf curl virus-New Delhi-Luffa (ToLCV-NDe-Luffa) (Sohrab et al., 2003), AV30F: 5'TTGGATCCATGGCGAAGCGACCA3' and AV31R: 5'AAGAGCTCTTAATTTGTGACCGA3', produced an amplicon of approximately 750 bp from three symptomatic samples but not from an asymptomatic sample (Fig. 2).
When the same samples were used in dot-blot hybridisation with a P32-labelled probe to the CP gene of ToLCV-NDe-Luffa, a weak hybridisation signal was obtained in two out of three symptomatic samples (Fig. 3). The absence of hybridisation in the third symptomatic sample may have been due to low virus titer, which could be detected by PCR but not by dot-blot hybridisation. The virus associated with diseased chayote was experimentally transmitted to Luffa acutangula and Nicotiana benthamiana by sap inoculation and to L. acutangula by whitefly transmission using Bemisia tabaci.
The putative CP PCR product was cloned and sequenced. A partial sequence of 533 nucleotides was obtained from the beginning of the coat protein gene. Sequence analysis showed that the virus associated with the yellow mosaic disease of chayote occurring in India shared 93-95% identity with the sequences of 12 begomovirus isolates available from the GenBank database. The maximum sequence identity (95%) was found with ToLCV-NDe from Pakistan (AF448058), but shared only 70.7% identity with the uncharacterised Chayote yellow mosaic virus (ChYMV; AJ223191), reported from Nigeria.
Here we report for the first time the occurrence of a new yellow mosaic disease of chayote in India, associated with a begomovirus. The data presented here strongly suggests that this virus is closely-related to ToLCV-Nde.
Sohrab SS, Mandal B, Pant RP, Varma A, 2003. First report of association of Tomato leaf curl virus New Delhi (ToLCV-NDe) with yellow mosaic disease of Luffa cylindrica in India. Plant Disease 87, 1148.
©2000 The Authors